Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

PEDB motif - Gene Atlas mashup table

Open Smart Phone View

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
Show API List
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Brain_Neural_tissues
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:amygdala label:cerebellum label:cerebral_cortex label:cerebral_cortex_prefrontal label:dorsal_root_ganglia label:dorsal_striatum label:hippocampus label:hypothalamus label:nucleus_accumbens label:olfactory_bulb label:spinal_cord
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 1464.85167 596.93923 911.05719 848.13055 488.52825 396.36375 722.44047 2064.0414 630.6757 796.16324 487.68935
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 298.29038 730.10168 669.66499 766.77142 2559.51731 1488.48954 204.00308 105.67697 783.49222 376.78991 168.0344
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 103.79138 4.63584 119.33562 139.4074 4.63584 119.82694 11.98733 11.90363 157.98198 923.7988 4.63584
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 6844.38691 2610.71929 2927.30852 3105.16087 3573.0792 4765.87707 3864.76931 7820.05317 6212.25562 7111.488 5027.71923
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 459.23024 133.8272 283.51854 319.75523 384.4689 657.20539 243.79031 392.64953 523.86278 923.87976 299.1736
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 428.3066 548.62491 440.74871 372.08372 683.41919 661.25282 429.15369 924.73517 613.13363 632.1498 458.12002
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 135.72946 204.69065 128.49241 179.4525 231.98885 148.11806 86.03803 150.3069 153.05139 134.70955 137.13359
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 287.04446 135.58944 210.82961 254.35314 120.9518 134.88131 172.47447 285.40453 270.08787 154.3513 118.95672
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 50.34709 17.87488 43.62062 70.93302 452.96835 42.36135 41.32637 29.5331 23.09235 16.20574 23.93615
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 561.4265 987.11705 834.97096 814.3592 2367.64978 1330.99326 644.52084 1110.21808 837.47324 814.45427 1183.58607
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 156.4994 249.72696 216.56368 218.44419 220.86775 251.81871 101.97736 224.09425 175.83419 262.95323 136.6924
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 156.4994 249.72696 216.56368 218.44419 220.86775 251.81871 101.97736 224.09425 175.83419 262.95323 136.6924
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.84609 4.7398 4.84609 4.84609 4.84609 4.84609 4.88478 4.84609 4.80284 4.79997 4.86902
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 251.07546 340.26646 190.75677 200.90777 147.3323 382.73519 135.38532 161.97358 203.82107 224.84577 185.17901
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 12.82791 204.0047 7.47204 56.38169 4.63584 23.1096 81.48211 11.26659 24.45813 227.42577 32.70062
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 180.96808 104.77756 187.14573 187.94938 81.14329 541.55571 158.60539 187.65556 191.78583 120.71968 113.65041
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 102.81115 293.19146 132.71731 143.84247 6.26403 308.86787 152.15169 212.74825 47.28197 33.63006 621.82698
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 1188.86837 597.34492 624.36323 592.23987 600.5109 535.72124 715.34457 2086.89018 586.41969 740.24872 812.32273
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 41.13281 24.38698 17.13105 17.14906 43.55606 17.28685 20.57991 47.8438 44.90444 17.62979 20.50445
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 41.13281 24.38698 17.13105 17.14906 43.55606 17.28685 20.57991 47.8438 44.90444 17.62979 20.50445
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 515.39236 1141.91135 201.81679 341.99678 91.10082 57.08716 147.10552 580.25732 356.78036 42.85881 56.38513
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 208.10338 4.63584 93.73747 113.2402 16.21559 15.12402 65.07561 156.32626 42.57413 48.49465 142.3764
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 1319.71526 516.05159 533.87128 764.24196 3009.99603 2062.61193 534.47258 2411.17346 2306.86369 1693.30897 1567.9532
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 251.71912 252.0668 311.28956 280.89067 102.81601 257.91344 323.39935 186.73568 290.61134 339.62807 133.31285
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 304.85581 273.30485 263.64194 236.25184 417.17155 110.41356 214.21198 394.85101 116.6113 120.35375 204.90975
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 321.30288 153.29177 207.90802 245.68873 99.34534 291.73303 199.98777 325.31545 734.61784 288.7401 139.2318
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 1565.96831 1988.71999 1571.67854 1453.32309 4751.03343 1451.23263 1907.80134 3440.39066 1527.21811 1339.8375 5052.20549
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 4.7055 4.73219 4.6965 4.63584 4.6965 4.75796 4.63584 4.6965 4.71275 4.75796 4.63584
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 104.81414 204.70801 150.37197 161.07678 112.53097 121.98067 127.23424 131.88211 221.70856 275.20061 401.56954
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 4.63705 4.63584 4.63584 4.63584 4.63584 4.63804 4.63728 4.63584 4.63584 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 18.3748 7.47965 6.13135 62.60904 7.33366 457.02624 9.3409 7.98013 1646.05723 19.97559 7.54826
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4498.64546 662.45722 2825.13328 2105.8346 784.14049 1785.05988 2372.02607 4385.8084 2676.47107 3022.40072 1024.10384
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 4.63746 4.63584 4.63584 13.79942 4.9607 12.44208 4.63584 4.63584 111.31247 4.63584 4.63584
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 135.34801 174.91667 129.6155 96.50361 295.00988 262.45581 155.36018 172.9818 142.89682 133.54985 164.59572
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.74141 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 4176.59055 2110.98334 3254.47266 3374.91827 4429.72241 1679.74765 4078.75044 7093.71711 3475.1557 3967.55547 5385.67201
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 10.12004 4.63584 4.719 4.63584 5.54615
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 10.12004 4.63584 4.719 4.63584 5.54615
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 10.12004 4.63584 4.719 4.63584 5.54615
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 8.57076 8.57837 9.07022 8.44211 23.31452 8.67235 8.6316 8.6316 8.86442 7.76832 8.53633
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 4.63584 4.63952 4.63584 4.63584 4.63584 4.63584 4.73012 4.66233 4.74964 4.71054 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 63.357 14.8257 72.16418 85.1577 209.54033 500.41812 27.66926 24.60859 149.99535 17.96898 14.14817
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 4516.8066 4183.93425 4895.43429 4947.96357 3253.64066 3706.97006 4257.7362 5284.71641 4536.70531 5395.93693 5110.81055
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 367.02517 9.44082 508.09368 669.18514 9.83401 1438.40282 96.40905 37.72011 1105.85231 78.0559 66.89295
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 367.02517 9.44082 508.09368 669.18514 9.83401 1438.40282 96.40905 37.72011 1105.85231 78.0559 66.89295
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 367.02517 9.44082 508.09368 669.18514 9.83401 1438.40282 96.40905 37.72011 1105.85231 78.0559 66.89295
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 131.6646 100.25462 342.18083 245.92027 34.58249 214.43429 108.3279 88.42099 210.91626 83.74117 38.28249
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 15323.7206 14278.64847 19327.30713 20580.47363 10290.71277 20275.46832 15660.62357 15817.21597 12700.19272 15608.72204 22307.43164
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 120.41234 4.87849 14.05884 23.94346 28.81941 36.39051 35.35627 11.02363 20.52549 17.00711 22.61875
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 4995.47574 2798.34548 4870.78124 4201.88571 2625.78542 7614.54834 4260.60894 9401.08499 8169.42374 8159.06166 8308.02739
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63693 4.63584 4.63584 4.63584 4.63974 4.97869 4.69725 4.63584 4.63584 4.63584 4.63584
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 132.1283 121.71396 239.26869 208.07353 116.7659 65.80745 108.93127 97.56321 128.70399 456.52899 104.01442
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 5.15746 7.58465 6.27031 5.70129 185.7451 6.32552 7.21235 6.65206 7.86472 7.27794 42.58598
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 104.54267 26.17856 40.49386 37.01201 53.54518 49.253 355.87774 131.04398 59.55593 84.00981 81.36207
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 4.63584 5.32465 31.68679 13.97244 4.63584 4.63584 6.21783 4.63584 4.63584 5.05467 6.07426
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.03194 4.77185 4.63584 4.63584 4.63584
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 3930.11165 6024.08259 4569.94118 3823.23733 3996.36351 3945.35261 4578.21881 4523.17751 4881.01872 6673.51628 6684.3657
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 12.21006 6.15283 6.1316 5.80137 8.56683 5.89493 9.66594 6.46735 6.17693 13.50239 5.9681
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 52.37126 64.02217 61.07309 86.41488 78.05859 171.29747 41.18164 54.53122 102.68813 58.81206 43.24282
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 663.83339 332.398 481.74952 562.82567 163.66963 880.82933 407.44554 524.74051 566.09393 730.64265 304.19874
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 235.58697 428.90198 273.97817 305.89121 1034.09574 662.7483 225.96703 200.82313 412.47441 121.6877 799.77373
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 76.77057 12.72122 85.53413 60.13343 28.56958 20.63569 34.41866 26.54474 15.72962 101.37926 11.12244
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 54.28358 419.8357 32.87681 61.41978 4.89626 223.26682 13.03812 22.66488 166.66762 4.88333 22.30173
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 281.62364 624.24814 273.84204 259.75466 99.96244 369.76156 273.38147 353.69799 405.76399 380.04909 129.71687
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 281.62364 624.24814 273.84204 259.75466 99.96244 369.76156 273.38147 353.69799 405.76399 380.04909 129.71687
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 6.14789 9.97322 6.14789 6.07083 5.71826 6.69852 23.42609 6.10301 6.29452 5.30977 6.14789
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 20.50349 18.45016 11.29922 21.25924 41.28603 20.84871 24.05527 21.46915 24.72519 14.85045 28.59935
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 53.21901 44.8696 58.16481 84.04116 55.20418 66.55966 128.47594 56.44941 34.93243 84.85985 66.20453
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 53.21901 44.8696 58.16481 84.04116 55.20418 66.55966 128.47594 56.44941 34.93243 84.85985 66.20453
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 2926.24768 4973.22215 3716.42828 3356.00213 3281.61964 4483.59742 2436.14067 4115.26022 5356.6467 3266.09283 2128.71337
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 926.88665 5.87885 75.02529 136.47244 7.06381 69.02988 103.1429 49.55012 231.07551 5.10934 17.32787
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 530.16061 397.96936 360.38325 444.13269 371.36358 611.81766 407.59455 569.06097 447.3122 383.8266 253.37775
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 31.47193 91.75344 49.9434 65.29967 6.72923 59.77709 15.62113 49.9007 87.23718 59.12159 23.47912
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 141.49885 302.87326 216.34753 152.39016 426.71979 130.49511 148.21305 315.32736 169.4512 223.32291 516.47903
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 6.06856 6.85901 5.79852 6.08642 5.64434 14.0431 7.62954 6.12706 5.68166 5.64434 8.8961
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 22.09073 12.29236 13.83984 11.47711 11.71614 8.88552 14.76862 16.70986 8.28043 13.11837 25.80814
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.21443 5.21443 5.21443 5.21443 4.91663 5.22063 5.21443 6.52035 5.21443 5.21443 5.21443
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 15109.00914 1360.47929 19031.70608 16555.2914 1446.28586 19390.80808 20502.83147 3517.15258 13119.08195 3229.48288 2193.19851
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 3197.4384 6208.67089 4032.12824 3896.54059 3014.17424 3893.06572 3430.29077 3961.55198 3316.24598 3581.96207 2914.80232
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 177.54193 54.68025 24.90869 66.55373 476.65333 274.91716 218.2914 392.39913 246.383 62.6067 60.45079
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 10.66831 12.47755 12.2284 8.72695 12.98481 9.55378 12.01499 7.49026 11.77976 12.90922 12.2284
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 15.3528 6.3327 8.73747 13.61677 7.17419 9.24218 55.12871 8.99185 8.21164 7.58344 11.47742
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 4.68228 4.75518 7.03245 4.80231 4.659 5.0117 4.83059 4.68228 5.90508 4.68228 4.70142
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 20.84874 15.334 30.65886 31.21313 30.47862 18.14253 28.67919 10.19223 8.83369 15.12517 24.36278
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 4.63584 4.63584 4.63584 4.63584 4.63584 5.89436 4.63584 4.63584 4.64236 4.63584 4.63584
* Row count is limited to 100.