Contact

Link and Publish your data

to the Linked Open Data Community

Linkdata Work Information

PEDB motif - Gene Atlas mashup table

Open Smart Phone View

Systematic microarray analysis (Gene Atlas) of mouse GPCR expressions in various cell types including macrophage and other tissues, combined with clock-controlled elements by computational prediction (PEDB). We selected probe set with highest mean intensity across all the samples in the dataset as a gene representative from Gene Atlas, then sorted the cell panel sample types into cell type (Lymphocytes, Myeloid leukocytes, ..., Derived cells) and into organ types (Brain & Neural tissues, Eye, .... Reproductive organs). The motifs range from -100000 to +100000 relative to the TSS, we focused on the motifs of from -10000 to -1.


References (for PEDB)
http://www.ncbi.nlm.nih.gov/pubmed/18815372
References (for Gene Atlas)
http://www.ncbi.nlm.nih.gov/pubmed/18442421




Descriptions for each data table:
PEDB_GeneAtlas_Fibroblast This collection of Gene Expression Properties are associated with Fibroblasts.
PEDB_GeneAtlas_White_Brown_adipose This collection of Gene Expression Properties are associated with White and Brown adiposes.
PEDB_GeneAtlas_Respiration_organ This collection of Gene Expression Properties are associated with Raspiration organ.
PEDB_GeneAtlas_Reproductive_organ This collection of Gene Expression Properties are associated with Reproductive organs, that is, Female specific organs (placenta, uterus, ovary, umbilical_cord) & Male-specific organs (bladder, prostate, testis) .
PEDB_GeneAtlas_Epidermis This collection of Gene Expression Properties are associated with Epidermis.
PEDB_GeneAtlas_Digestive_system_organ This collection of Gene Expression Properties are associated with Digestive system organs.
PEDB_GeneAtlas_Gland This collection of Gene Expression Properties are associated with Glands such as salivary gland and lacrimal gland.
PEDB_GeneAtlas_Trunk_Abdomen_organ This collection of Gene Expression Properties are associated with Trunk organ (pancreas) & Abdomen organ (liver, kidney).
PEDB_GeneAtlas_Endocrine_gland This collection of Gene Expression Properties are associated with Endocrine glands.
PEDB_GeneAtlas_Heart_Muscle This collection of Gene Expression Properties are associated with Heart & Muscles.
PEDB_GeneAtlas_Stem_cells_Progenitors This collection of Gene Expression Properties are associated with Stem cells & Progenitors.
PEDB_GeneAtlas_Lymphocytes This collection of Gene Expression Properties are associated with Lymphocytes, that is, T-cells, Natural Killer cells, B-cells.
PEDB_GeneAtlas_Dendritic_cells This collection of Gene Expression Properties are associated with Dendritic cells.
PEDB_GeneAtlas_Myeloid_leukocytes This collection of Gene Expression Properties are associated with Myeloid leukocytes, that is, mast cell, macrophage, granulocyte, microglia.
PEDB_GeneAtlas_Osteoblasts_Osteoclasts This collection of Gene Expression Properties are associated with Osteoblast & Osteoclast.
PEDB_GeneAtlas_Spleen_Lymph_node This collection of Gene Expression Properties are associated with Spleen & Lymph node.
PEDB_GeneAtlas_Derived_cells This collection of Gene Expression Properties are associated with artificially derived cells.
PEDB_GeneAtlas_Eye This collection of Gene Expression Properties are associated with Eye.
PEDB_GeneAtlas_Brain_Neural_tissues This collection of Gene Expression Properties are associated with Brain & Neural tissues.
2

value

useful
0
Loading...



Select a file name to see the detais.
Show API List
   
#LINK
#lang en
#attribution_name GenoCon
#attribution_url http://promotercad.org
#license http://creativecommons.org/licenses/by/3.0/deed.en
#file_name PEDB_GeneAtlas_Myeloid_leukocytes
#download_from http://linkdata.org/work/rdf1s912i
#namespace BioGPS http://biogps.org/#goto=genereport&id=
#namespace Gene http://www.ncbi.nlm.nih.gov/gene/
#namespace PEDB http://promoter.cdb.riken.jp/cgi-bin/searchGene.cgi?SP=Mouse&FIELD=GeneID&QUE=
#namespace PEDB_motif http://promoter.cdb.riken.jp/cgi-bin/eleData.cgi?db=mouse_mapping_33&id=
#property motif motif type motif sequence motif position chromosome strand start end TSS PEDB BioGPS altId Probe ID label:granulocytes_mac1+gr1+ label:macrophage_bone_marrow_0hr label:macrophage_bone_marrow_2hr_LPS label:macrophage_bone_marrow_6hr_LPS label:macrophage_bone_marrow_24h_LPS label:macrophage_peri_LPS_thio_0hrs label:macrophage_peri_LPS_thio_1hrs label:macrophage_peri_LPS_thio_7hrs label:mast_cells label:mast_cells_IgE label:mast_cells_IgE+antigen_1hr label:mast_cells_IgE+antigen_6hr label:microglia
#object_type_xsd string string string float string string integer integer integer string string string string float float float float float float float float float float float float float
#property_context Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion Assertion
Gene:102910 PEDB_motif:19768833 E-box AGCCCCCACGTGACCCGG 3015.5 X + 124693675 124693658 124696682 PEDB:102910 BioGPS:102910 1427167_at 8.4182 7.90719 7.99981 5.86782 6.61074 6.1811 6.10343 7.90476 7.4272 7.84138 7.42492 8.20634 28.70671
Gene:110651 PEDB_motif:19771750 RRE AACCAGTGACCTACTTTCTATCT 8945 X + 149237195 149237173 149246129 PEDB:110651 BioGPS:110651 Rps6ka3 1455206_at 907.30793 2478.60966 2129.25131 3010.15507 663.62398 2249.03298 1619.68211 1094.36347 2081.82119 2697.84832 2081.54832 1916.32381 1261.1739
Gene:11878 PEDB_motif:19771030 D-box CAAGCGGATTATGTCACATTTCCT 4046.5 X + 84833993 84834016 84838051 PEDB:11878 BioGPS:11878 Arx 1450042_at 4.63584 4.63584 4.63584 5.88088 4.63584 4.63584 5.07079 4.63584 4.85311 4.63584 4.63584 4.63584 41.44748
Gene:12070 PEDB_motif:19768588 E-box GGCCCTCACGTGACCCGG 524.5 X + 126277453 126277436 126277969 PEDB:12070 BioGPS:12070 Ngfrap1 1428842_a_at 147.78182 1015.51065 959.43449 653.55789 574.58424 403.68052 388.04203 185.24203 235.25351 273.6197 353.81134 210.77923 555.56862
Gene:15354 PEDB_motif:19771031 D-box CTGGCTCATCACATAATCAGAAGC 5346.5 X + 63116803 63116780 63122138 PEDB:15354 BioGPS:15354 1416155_at 418.541 992.058 870.35738 111.60414 19.0211 25.99151 18.39093 17.65035 120.29256 68.22881 101.9665 169.8552 238.61049
Gene:16179 PEDB_motif:19773717 RRE AGAAAATAAGTAGGTCGTTTTAA 3145 X - 65585461 65585439 65582305 PEDB:16179 BioGPS:16179 1438120_x_at 736.19354 944.49761 796.9165 532.44871 1133.4674 1777.5539 1347.32219 1061.77068 1236.83392 4170.90698 1810.11767 1419.30639 1185.9003
Gene:17763 PEDB_motif:19771695 RRE CAGTACTGACCTAATTTGGATCT 697 X - 66967616 66967638 66966930 PEDB:17763 BioGPS:17763 1449897_a_at 97.45037 237.64849 172.48475 97.29636 233.45445 151.41162 119.99283 96.67438 1134.90235 591.43552 458.63716 418.23181 75.50456
Gene:18715 PEDB_motif:19774599 RRE CCCAGCCAGGTGGGTCATGGACT 6061 X + 6161170 6161192 6167242 PEDB:18715 BioGPS:18715 Pim2 1417216_at 7.79887 18.18084 87.4323 104.98178 14.65364 10.28173 8.01311 18.9256 1131.28157 11.27136 10.27049 26.08523 285.81737
Gene:18824 PEDB_motif:19768567 E-box GGCCTCCACCTGGCCCGG 44.5 X - 5960387 5960404 5960351 PEDB:18824 BioGPS:18824 NM_019755.2 1453572_a_at 5067.6241 17656.0834 15985.64912 8157.99868 6096.32141 6392.23439 6075.26577 3805.79938 1803.09958 7335.70182 6969.06325 4685.08234 5610.31794
Gene:20229 PEDB_motif:19769416 D-box TGTGGGTGTTATGTAACACCTGTT 105.5 X - 145130299 145130276 145130182 PEDB:20229 BioGPS:20229 Sat1 1420502_at 3381.65286 7701.08235 8130.38024 14668.5526 17956.9341 12109.58616 13558.06793 13007.85961 9171.4152 2820.8231 2890.75078 3517.67901 10423.77579
Gene:20591 PEDB_motif:19768316 E-box CCTTGCCACTTGCAGCCT 9138.5 X + 142111539 142111556 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 372.73291 153.4635 191.54172 257.05834 213.14568 239.03604 233.91641 522.34988 461.28104 2191.67257 651.35677 939.58618 383.94803
Gene:20591 PEDB_motif:19773274 RRE ATGAAATGAACTATTTTCTCTTA 190 X + 142120507 142120485 142120686 PEDB:20591 BioGPS:20591 ENSMUSG00000025332 1444158_at 372.73291 153.4635 191.54172 257.05834 213.14568 239.03604 233.91641 522.34988 461.28104 2191.67257 651.35677 939.58618 383.94803
Gene:21947 PEDB_motif:19773918 RRE GGTAGAAAAATAGGTCAGGAGAA 1847 X + 48862751 48862773 48864609 PEDB:21947 BioGPS:21947 Cd40lg 1422283_at 4.84609 4.84609 4.84609 4.84609 5.39271 5.60233 10.12536 6.21445 4.84609 6.74978 5.14515 4.84609 4.8999
Gene:22289 PEDB_motif:19768574 E-box AAAGGTCACGTGAGGCGA 56.5 X + 16494263 16494280 16494328 PEDB:22289 BioGPS:22289 ENSMUSG00000037369 1427672_a_at 285.25048 268.69094 296.72682 163.51978 306.06318 435.58331 548.49374 253.54274 3443.92336 1748.37642 913.08493 1265.94694 374.95205
Gene:22773 PEDB_motif:19773957 RRE CGGTACCCGGTAGGTCAGCGGCG 2331 X + 49680767 49680789 49683109 PEDB:22773 BioGPS:22773 Zic3 1423424_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.01234 4.63584 4.63584 4.63584 4.63584 4.63584 6.87407
Gene:236904 PEDB_motif:19768510 E-box CCCTGGCTCGTGGCCCTC 31.5 X + 85786432 85786415 85786455 PEDB:236904 BioGPS:236904 Klhl15 1435818_at 104.18037 33.21996 13.07613 20.27184 87.05314 38.07423 28.69489 23.89893 138.64695 159.58776 96.97543 234.08822 38.68081
Gene:237010 PEDB_motif:19773072 RRE CCTTAATGAGCTACATTCAAATT 502 X + 105801294 105801272 105801785 PEDB:237010 BioGPS:237010 Klhl4 1439078_at 5.05726 6.26403 6.26403 6.26403 4.84197 5.05726 5.6284 5.6284 5.6284 5.6284 5.38879 4.63584 5.6284
Gene:237052 PEDB_motif:19768992 E-box TCCCCTCACGTGACCAGG 20.5 X + 126715154 126715137 126715166 PEDB:237052 BioGPS:237052 Tceal1 1424634_at 9.35735 35.01695 24.04425 11.30027 19.86431 58.99516 22.66959 10.79593 6.7402 9.53027 7.5302 7.41857 66.51694
Gene:23947 PEDB_motif:19771351 D-box TAATTTCATCACATACTCCCAGCC 3853.5 X + 130668276 130668253 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 6.26264 5.20717 4.63584 4.63584 4.63584 5.16549 5.79267 6.42361 5.74549 6.78982 4.99107 5.53011 8.54304
Gene:23947 PEDB_motif:19771009 D-box GCAGCTGCTTATGTGATGTGATTA 3734.5 X + 130668372 130668395 130672118 PEDB:23947 BioGPS:23947 Mid2 1422216_at 6.26264 5.20717 4.63584 4.63584 4.63584 5.16549 5.79267 6.42361 5.74549 6.78982 4.99107 5.53011 8.54304
Gene:23963 PEDB_motif:19772875 RRE AAAAAAAAAGTGGGACATAGATA 6174 X + 35771097 35771119 35777282 PEDB:23963 BioGPS:23963 ENSMUSG00000016150 1458842_at 5.00323 4.82193 4.82193 4.89672 4.81824 4.82193 4.82624 5.19369 4.81761 4.82624 5.00036 4.82624 4.72224
Gene:245643 PEDB_motif:19773385 RRE GAGGAGAAATAGGGTCAGTGAAG 5116 X + 130384006 130384028 130389133 PEDB:245643 BioGPS:245643 ENSMUSG00000042425 1441363_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:50786 PEDB_motif:19772915 RRE CCGCCCTGAGCCACTTTCCTGTT 1979 X - 43870538 43870560 43868570 PEDB:50786 BioGPS:50786 Hs6st2 1450047_at 5.92814 5.12993 5.08844 6.93708 5.5632 5.58523 5.92814 4.87663 14093.32337 20531.77207 9156.84695 7337.821 5.95161
Gene:53332 PEDB_motif:19771735 RRE TATATTAAAGTAGGTCATTTAAA 6626 X + 62950771 62950793 62957408 PEDB:53332 BioGPS:53332 Mtmr1 1421880_at 42.41458 221.51531 206.61825 138.31578 158.13266 216.55129 149.17066 60.07874 356.73573 369.21804 179.51767 243.03137 148.97304
Gene:55936 PEDB_motif:19773728 RRE CCACACTGACCTGCATTTACATT 4999 X + 152866130 152866108 152871118 PEDB:55936 BioGPS:55936 Ctps2 1448111_at 687.05806 745.54517 705.90443 570.11224 711.70121 1349.25609 1178.4391 446.77489 697.79086 843.91675 744.77889 565.56911 1108.28628
Gene:56364 PEDB_motif:19768718 E-box CGGGGCCCCGGGCGGGGG 178.5 X - 92823595 92823578 92823408 PEDB:56364 BioGPS:56364 Zmym3 1417794_at 31.53914 19.18187 22.54743 16.64604 35.44302 20.51515 23.47631 29.0638 46.91781 33.85315 20.02245 26.85076 27.59887
Gene:68041 PEDB_motif:19768369 E-box CATGTCCACGTGCATCCG 438.5 X + 9048714 9048731 9049161 PEDB:68041 BioGPS:68041 Mid1ip1 1416840_at 659.55143 2959.47246 2197.34643 1316.67198 1770.47049 3823.51231 3764.83352 1081.08193 1642.86733 415.98269 647.56768 532.27057 1482.62568
Gene:107527 PEDB_motif:19772271 RRE AGAAACTGACCTATTTAACAAAT 9888 1 + 40639434 40639412 40649311 PEDB:107527 BioGPS:107527 1434903_s_at 7.42973 6.21457 6.72453 6.77332 9.70797 56.12927 55.85546 40.83174 4.75796 10.14893 9.23233 11.42005 15.21209
Gene:108657 PEDB_motif:19768502 E-box GCCATGCACGTGGCCTCG 63.5 1 + 92844682 92844665 92844737 PEDB:108657 BioGPS:108657 Rnpepl1 1454753_at 376.78686 548.91728 481.38143 886.70992 462.07304 1287.14786 987.02254 1510.67641 940.96143 654.82676 353.77105 208.19689 405.85132
Gene:114668 PEDB_motif:19772824 RRE GGTAACTGACCCACTTCCCAGCA 1466 1 - 185095561 185095583 185094106 PEDB:114668 BioGPS:114668 1432336_at 5.9145 4.63584 4.63584 4.63584 5.02994 4.63584 5.22431 4.63584 4.63584 4.63584 4.88993 4.63584 4.63584
Gene:11807 PEDB_motif:19774116 RRE AGGAAATGACCTCCTTTCAAATC 453 1 + 171292974 171292952 171293416 PEDB:11807 BioGPS:11807 1417950_a_at 7.33861 9.93409 8.67267 16.24164 7.35997 7.23984 7.35997 7.35997 6.47966 7.53869 8.04397 7.35997 7.79994
Gene:11899 PEDB_motif:19768784 E-box CTACTCCACGTGGCTCCC 7842.5 1 + 158597213 158597196 158605047 PEDB:11899 BioGPS:11899 Astn1 1418615_at 4.86452 4.7488 4.86452 9.35745 5.84091 4.95829 6.21447 4.86452 5.91207 4.86452 4.86452 4.86452 25.81126
Gene:11905 PEDB_motif:19769536 D-box AGCACTGGTTATGTAATAAGTTAC 9238.5 1 + 160977516 160977539 160986766 PEDB:11905 BioGPS:11905 Serpinc1 1417909_at 5.11335 4.8036 5.09646 7.27322 5.04643 5.2996 4.63584 5.84964 4.93622 5.08522 4.81233 4.63584 4.90035
Gene:12946 PEDB_motif:19770374 D-box ACAAGTTGGTATATAATGAAATTG 9604.5 1 - 195034538 195034515 195024922 PEDB:12946 BioGPS:12946 ENSMUSG00000016481 1422563_at 1099.30518 1672.17758 1879.5364 1821.68202 915.0027 1309.46876 1381.7451 1933.34166 4846.3149 2164.88234 2271.54871 1894.13125 1012.33188
Gene:13798 PEDB_motif:19768898 E-box CCGCACCACGAGGCCCCA 4248.5 1 + 120371788 120371771 120376028 PEDB:13798 BioGPS:13798 En1 1418618_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:13800 PEDB_motif:19771267 D-box GCTGTGTGTTATGTAAGCTTATAT 8872.5 1 - 182016255 182016232 182007371 PEDB:13800 BioGPS:13800 Enah 1424800_at 32.20244 4.96128 7.73557 8.51754 8.58372 5.54932 6.86662 7.09865 15676.01742 9151.51587 4050.03542 3910.49891 243.28678
Gene:14472 PEDB_motif:19768534 E-box CGGTCCCACGTGACACGA 71.5 1 - 89839742 89839725 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.75536 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19770175 D-box TGCTTGTGATACATAACACACGTC 1314.5 1 - 89840965 89840988 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.75536 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:14472 PEDB_motif:19769605 D-box TGGCTCTTTTACATAATTGCAGGA 3629.5 1 - 89843280 89843303 89839662 PEDB:14472 BioGPS:14472 1420337_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.75536 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:15365 PEDB_motif:19770989 D-box ACTGCATTTTACATAATTCCCTCT 4879.5 1 - 177133381 177133404 177128513 PEDB:15365 BioGPS:15365 1440559_at 528.17599 231.95243 14.37612 17.62826 27.75574 45.30649 10.06254 12.00351 36.0587 160.68517 266.38741 201.00245 65.51042
Gene:16171 PEDB_motif:19772476 RRE GTTTTCTGACCCACTTTAAATCA 8686 1 + 20931107 20931085 20939782 PEDB:16171 BioGPS:16171 1421672_at 7.79626 4.63584 4.63584 4.63584 4.63584 4.63584 5.69911 7.48541 4.63584 4.63584 4.63584 4.88173 4.63584
Gene:17912 PEDB_motif:19771620 RRE TGGTGCTGACCCACTTTCCTCTT 41 1 - 52269988 52270010 52269958 PEDB:17912 BioGPS:17912 Myo1b 1459679_s_at 5.38834 7.12171 10.39788 5.31114 5.23503 7.81692 7.98995 5.38834 5.31114 5.2945 5.08135 4.92634 84.93382
Gene:17975 PEDB_motif:19774664 RRE TCTCATTGAGCTCCTTTCTGTCC 444 1 - 86236626 86236648 86236193 PEDB:17975 BioGPS:17975 Ncl 1415771_at 600.66612 10414.35618 10509.09072 6934.46443 5630.8857 7071.69673 6136.23492 6293.21595 9540.6702 497.09257 2561.45434 4625.7749 8852.20657
Gene:18143 PEDB_motif:19771792 RRE AGAGAATGACCTACTTTACTGGG 1857 1 + 39515362 39515340 39517208 PEDB:18143 BioGPS:18143 1421037_at 9.78147 16.88601 12.39491 8.21497 23.21102 42.8236 15.77959 9.93771 7.68205 8.64633 8.64633 8.64633 7.61873
Gene:18143 PEDB_motif:19772187 RRE GAAAAATATGTAGGTCAGTGGAA 926 1 + 39516271 39516293 39517208 PEDB:18143 BioGPS:18143 1421037_at 9.78147 16.88601 12.39491 8.21497 23.21102 42.8236 15.77959 9.93771 7.68205 8.64633 8.64633 8.64633 7.61873
Gene:18143 PEDB_motif:19773603 RRE GATCCTTGACCCATTTTCCTGAC 761 1 + 39516458 39516436 39517208 PEDB:18143 BioGPS:18143 1421037_at 9.78147 16.88601 12.39491 8.21497 23.21102 42.8236 15.77959 9.93771 7.68205 8.64633 8.64633 8.64633 7.61873
Gene:18627 PEDB_motif:19769182 D-box TGTGCGTCTTATGTAAAGAGAGCG 115.5 1 - 91377818 91377795 91377691 PEDB:18627 BioGPS:18627 Per2 1417602_at 28.4288 11.5807 7.56587 18.82122 54.72628 14.39209 17.54443 21.36207 114.2201 69.22804 98.56863 39.93116 18.46302
Gene:19243 PEDB_motif:19769588 D-box TGATGTTCTTATGTAAGGCTGCCT 4565.5 1 - 31225943 31225920 31221366 PEDB:19243 BioGPS:19243 Ptp4a1 1438657_x_at 12432.00251 8417.00719 8103.81638 5877.1632 12878.16587 14073.49389 14190.11834 13937.13181 14692.45629 28825.3417 20147.34209 16252.27461 13653.84894
Gene:19264 PEDB_motif:19774430 RRE CATGGCTGACCTAGTTAATTTCT 464 1 - 137962189 137962211 137961736 PEDB:19264 BioGPS:19264 Ptprc 1422124_a_at 7263.16432 7439.81474 7829.95033 9249.73514 6662.681 8602.51488 8378.01386 12145.9783 8061.15566 16402.66072 10063.8355 8714.16784 7241.82701
Gene:20720 PEDB_motif:19768655 E-box ACGATCCACGTGCAGCTC 255.5 1 - 80372573 80372556 80372309 PEDB:20720 BioGPS:20720 Serpine2 1416666_at 185.91206 5.35211 6.19772 8.08607 5.35211 4.78764 8.08743 7.75202 5.48847 6.17906 6.87479 22.8424 1133.76105
Gene:20724 PEDB_motif:19774336 RRE AGATCTTGTCCTACTTTAAACGT 3888 1 + 106839300 106839278 106843177 PEDB:20724 BioGPS:20724 Serpinb5 1441941_x_at 4.63584 4.63584 4.63584 5.63683 4.63584 4.63584 5.07455 5.21303 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:208727 PEDB_motif:19769459 D-box TCTGCTTGTTATGTAATGTGACAA 53.5 1 - 92038581 92038558 92038516 PEDB:208727 BioGPS:208727 Hdac4 1436758_at 79.84299 48.09948 60.03933 29.06418 102.95995 34.88766 55.96277 35.14229 84.13604 43.12216 56.26142 53.39033 54.58544
Gene:212980 PEDB_motif:19768570 E-box AGGAGCCACGCGGGGGCT 174.5 1 + 131835074 131835091 131835257 PEDB:212980 BioGPS:212980 Slc45a3 1426664_x_at 9.67447 9.87266 7.01355 8.34354 7.79282 12.324 8.53977 35.54569 3442.35515 3139.70098 1320.19511 2167.1473 23.27391
Gene:21808 PEDB_motif:19771540 RRE GTTGAAAAAGTGGGTCAGAAACA 3633 1 - 186297243 186297221 186293599 PEDB:21808 BioGPS:21808 Tgfb2 1423250_a_at 7.75784 7.29777 6.4959 11.13563 10.74943 19.93926 21.41646 18.52504 5.48713 10.19435 8.39113 7.65557 26.85595
Gene:22409 PEDB_motif:19768520 E-box TGAGGCCACGTGCTCCCA 2531.5 1 + 75249086 75249103 75251626 PEDB:22409 BioGPS:22409 1460657_at 5.92165 4.63584 5.52847 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 5.40634 4.63584 4.63584 4.63584
Gene:22637 PEDB_motif:19769028 E-box CAGGAGCATGTGGCCTGT 58.5 1 + 37084421 37084404 37084471 PEDB:22637 BioGPS:22637 1422701_at 4.63584 4.63584 4.63584 4.63584 5.43484 4.63584 4.63584 7.42006 4.63584 4.63584 5.82587 4.63584 4.63584
Gene:226646 PEDB_motif:19774526 RRE TGGCCCTGACTTATTTTCCACTT 135 1 - 171312375 171312397 171312251 PEDB:226646 BioGPS:226646 Ndufs2 1451096_at 2007.0935 2615.58472 2444.0075 2394.17468 2627.08972 2254.71525 2028.67048 1646.05891 2547.81219 1336.53937 2097.35954 2397.88553 2771.32106
Gene:226896 PEDB_motif:19769547 D-box CGGCAAGATTACATAATGAAGTCA 8425.5 1 + 19301791 19301768 19310205 PEDB:226896 BioGPS:226896 ENSMUSG00000042596 1425443_at 8.96309 7.39082 10.73079 6.80239 24.01162 6.01442 5.9681 9.17969 6.11155 9.0591 10.11097 12.91151 7.85704
Gene:227195 PEDB_motif:19769078 E-box AGGAGTCAGGTGCAGCCG 570.5 1 - 63506259 63506242 63505680 PEDB:227195 BioGPS:227195 ENSMUSG00000040865 1439180_at 121.33579 58.66944 67.319 48.90249 55.8909 108.76328 105.54377 100.96181 240.92124 409.75029 255.514 305.64077 59.30544
Gene:22782 PEDB_motif:19768213 E-box CCGCTGCACGCGGCCCGC 331.5 1 + 191802619 191802602 191802942 PEDB:22782 BioGPS:22782 Slc30a1 1436164_at 265.22596 386.38658 198.20532 243.19717 844.93273 3596.24405 1886.5332 1786.46463 238.22816 19.91824 62.81789 32.61543 334.27062
Gene:23792 PEDB_motif:19768711 E-box CATGGCCACGAGCAGGCT 3873.5 1 + 63973688 63973705 63977570 PEDB:23792 BioGPS:23792 Adam23 1447946_at 4.72992 5.64526 5.34691 5.14509 6.64278 5.77511 5.34691 4.94656 4.82591 5.27922 4.63584 4.63584 5.07332
Gene:240843 PEDB_motif:19773490 RRE AGAAGGAAAATGGCTCAAATGGG 402 1 - 158356916 158356894 158356503 PEDB:240843 BioGPS:240843 1438706_at 5.04028 4.63584 4.63584 5.8271 4.63584 4.63584 5.61959 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:241201 PEDB_motif:19773786 RRE AAGAAAAAAGTAGGGCAGTCCGA 988 1 + 109986639 109986661 109987638 PEDB:241201 BioGPS:241201 Cdh7 1460045_at 7.33401 4.63584 4.63584 5.70828 4.63584 4.63584 4.63584 4.63584 4.63584 5.02149 4.63584 4.63584 4.88045
Gene:56210 PEDB_motif:19774591 RRE TCTCACAGACCCACTGTCTCCCG 135 1 - 38321180 38321202 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 56.63494 180.88188 180.27731 133.5263 114.69244 249.82535 159.07235 206.39851 356.02578 310.44002 161.98822 179.86088 261.42421
Gene:56210 PEDB_motif:19768620 E-box ACGGCGCTCGCGGCCCCG 171.5 1 - 38321219 38321236 38321056 PEDB:56210 BioGPS:56210 ENSMUSG00000026082 1422624_at 56.63494 180.88188 180.27731 133.5263 114.69244 249.82535 159.07235 206.39851 356.02578 310.44002 161.98822 179.86088 261.42421
Gene:57339 PEDB_motif:19768486 E-box CCGGCTCACGTGGGCGGG 97.5 1 - 17304394 17304411 17304305 PEDB:57339 BioGPS:57339 1421520_at 12.05677 6.53094 6.4475 8.61009 6.75536 6.14789 6.14789 6.14789 6.06952 9.12592 9.30075 7.64642 6.3374
Gene:66153 PEDB_motif:19769885 D-box AATAGGTTTTATGTAATCCACACA 1549.5 1 + 85366830 85366853 85368391 PEDB:66153 BioGPS:66153 1449418_s_at 31.3154 36.20371 42.91975 45.18533 74.95232 40.72347 31.95837 30.41141 87.64622 25.92353 30.41141 31.17529 46.0278
Gene:69953 PEDB_motif:19774067 RRE ACTTCCTGAGCCAGTTTCTCTCT 8131 1 + 157405753 157405731 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 34.74377 55.75883 55.65078 41.77135 19.17785 50.18162 59.82283 33.97868 14.37607 15.31848 17.20951 15.31848 335.06225
Gene:69953 PEDB_motif:19770636 D-box AAGAACTATTACATAAAACCCTCT 7040.5 1 + 157406844 157406821 157413873 PEDB:69953 BioGPS:69953 2810025M15Rik 1428452_at 34.74377 55.75883 55.65078 41.77135 19.17785 50.18162 59.82283 33.97868 14.37607 15.31848 17.20951 15.31848 335.06225
Gene:70579 PEDB_motif:19768589 E-box CCGTGACACGTGACCCTA 135.5 1 - 133549397 133549380 133549253 PEDB:70579 BioGPS:70579 Zc3h11a 1415764_at 1761.98361 2158.23578 3020.63431 3447.4006 2288.23434 3836.77579 4451.35328 3454.84387 4458.08494 10300.86637 4398.20872 3729.71517 3022.61742
Gene:72585 PEDB_motif:19769002 E-box AGCCGTCACGTGGTACCC 29.5 1 - 125743531 125743548 125743510 PEDB:72585 BioGPS:72585 Lypd1 1431569_a_at 4.64697 5.22818 5.68489 4.64697 5.27172 4.83478 6.46694 5.53727 4.64697 4.64697 4.64697 4.64697 6.37003
Gene:72750 PEDB_motif:19768845 E-box CAGCCCCACGCGCGGCGG 245.5 1 + 60317274 60317291 60317528 PEDB:72750 BioGPS:72750 1434010_at 490.54511 179.49594 108.52361 50.05041 160.69608 245.84547 154.97218 67.10755 659.16558 1280.98465 533.64354 708.83941 193.71514
Gene:72951 PEDB_motif:19768336 E-box ACCAACCACGTGAGGGCG 213.5 1 - 26071450 26071433 26071228 PEDB:72951 BioGPS:72951 1433388_at 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:78605 PEDB_motif:19773988 RRE TGATTAAAAATAGGTCACCCAAA 3201 1 - 88190666 88190644 88187454 PEDB:78605 BioGPS:78605 1433685_a_at 464.80326 852.97931 537.70364 311.39044 122.0002 107.06365 34.59 77.88921 136.41983 332.78609 157.24193 183.8258 178.67632
Gene:80721 PEDB_motif:19770522 D-box GGAGCCCCTTATGTACCCTCTACA 6851.5 1 - 83569648 83569625 83562785 PEDB:80721 BioGPS:80721 Slc19a3 1436417_at 5.64434 5.64434 5.70902 5.64434 5.64434 5.64434 5.64434 6.47206 5.64434 5.64434 5.64434 5.64434 5.64434
Gene:93840 PEDB_motif:19770848 D-box GAGACTGATTAAATAAGGGGAATT 8616.5 1 - 172087920 172087943 172079315 PEDB:93840 BioGPS:93840 ENSMUSG00000026556 1436118_at 16.64131 8.88552 9.8839 10.88238 10.00214 12.247 11.5151 11.79933 9.50517 8.88552 11.71614 11.22758 17.76742
Gene:93842 PEDB_motif:19768105 E-box AGAGCCCACGTGCGACCG 161.5 1 + 172606324 172606341 172606494 PEDB:93842 BioGPS:93842 Igsf9 1420518_a_at 5.0403 11.01113 7.14389 10.67879 5.21443 5.21443 6.41678 6.83707 5.21443 5.21443 5.21443 5.21443 14.9893
Gene:96890 PEDB_motif:19768206 E-box AGGGGCCAGGTGCGGGCA 1300.5 1 - 134907665 134907648 134906356 PEDB:96890 BioGPS:96890 1445905_at 4.63584 4.63584 4.63584 4.63584 4.94413 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584 4.63584
Gene:108699 PEDB_motif:19770201 D-box GCTGCTTCTTACGTAATGCTGCTC 2275.5 2 - 73551513 73551490 73549226 PEDB:108699 BioGPS:108699 1420545_a_at 10.05624 10.46537 7.49349 9.59285 9.49734 7.95627 7.00261 5.8969 6.86736 7.53621 6.55878 6.57438 20.84051
Gene:11800 PEDB_motif:19774690 RRE GCACAAGAAGTTGGTCAGCTTGC 5498 2 - 94306224 94306202 94300715 PEDB:11800 BioGPS:11800 Api5 1437593_x_at 6525.36291 6736.07531 5701.44862 5489.1306 5086.99229 6440.65669 5264.87449 6122.97309 7594.0878 14259.44314 8557.61473 7086.11612 8415.22929
Gene:11898 PEDB_motif:19768228 E-box CGTCCCCACGTGTCCCAG 30.5 2 + 31430268 31430251 31430290 PEDB:11898 BioGPS:11898 Ass1 1416239_at 79.40089 548.76156 571.59019 3088.58906 3606.65018 50.66422 74.96397 854.90462 5.76515 7.86069 8.7917 7.3467 95.17731
Gene:12236 PEDB_motif:19770833 D-box CAAATATATTACATAGTAGCAGGA 7196.5 2 + 118405965 118405942 118413150 PEDB:12236 BioGPS:12236 Bub1b 1447363_s_at 641.03447 587.66117 498.15393 62.10318 46.37447 29.04771 42.56542 12.98481 12.14088 215.45331 99.59475 181.59896 51.76357
Gene:12335 PEDB_motif:19769577 D-box TGGCCCTCTTATGTAACCACCCTG 6867.5 2 + 120238570 120238593 120245449 PEDB:12335 BioGPS:12335 Capn3 1433681_x_at 8.1088 9.09839 8.49822 9.91953 9.85642 7.18081 9.82303 7.92401 9.90016 8.95138 10.30413 10.57544 11.67651
Gene:13537 PEDB_motif:19768509 E-box GAGTCCCACGTGAAGCCG 106.5 2 + 127085067 127085084 127085182 PEDB:13537 BioGPS:13537 1450698_at 11.8053 7.44722 718.13859 424.26613 11.26506 53.88167 1675.04058 48.39112 160.10198 7.44722 34.44154 6.68725 13.63486
Gene:13555 PEDB_motif:19768429 E-box CGGCGGCGCGTGGCTCTT 47.5 2 - 154633240 154633257 154633201 PEDB:13555 BioGPS:13555 E2f1 1431875_a_at 41.10811 397.46267 286.51114 83.30391 258.97371 127.53756 126.35508 32.08051 80.17673 47.90791 51.99501 52.90886 141.59353
Gene:13661 PEDB_motif:19769873 D-box GGTGGGTTTTATGTTAACAACCTA 2502.5 2 - 103186490 103186467 103183976 PEDB:13661 BioGPS:13661 Ehf 1451375_at 5.40963 4.63584 4.63584 4.63584 4.63584 4.63584 5.22759 4.63584 4.63584 4.94643 4.91725 4.63584 4.63584
* Row count is limited to 100.